VetGen - The leader in veterinary genetic disease research and genetic disease detection services for purebred animals

A Kinase-Negative Mutation of DNA-PKCS in Equine SCID Results in Defective Coding and Signal Joint Formation

The Journal of Immunology Vol. 158, No. 08 Issue of 04-15-97 pp 3565-3569

Euy Kyun Shin, Lance E. Perryman, and Katheryn Meek

Harold C. Simmons Arthritis Research Center and Departments of Internal Medicine and Microbiology, University of Texas Southwestern Medical Center, Dallas, TX 75235; and Department of Microbiology, Pathology, and Parasitology, College of Veterinary Medicine, North Carolina State University, Raleigh, NC 27606


Contents


Abstract

The equine SCID defect is more severe than its murine counterpart in that SCID foals are incapable of forming either coding or signal joints, whereas SCID mice manifest normal signal joint formation. To determine the basis of this difference and whether DNA-dependent kinase, catalytic subunit (DNA-PKCS), is involved in signal joint formation, equine DNA-PKCS transcripts were cloned and sequenced from normal and SCID cell lines. In the mutant allele, a frame-shift mutation truncates the protein N terminal of the domain with homology to the phosphatidylinositol 3-kinase family resulting in complete absence of full length DNA-PKCS and accounting for the kinase-negative phenotype of these cells; the mutation in SCID mice allows for some DNA-PKCS expression. The difference in DNA-PKCS expression in SCID mice and foals explains the more severe phenotype of equine SCID, and definition of DNA-PKCS as the defect in equine SCID demonstrates that DNA-PKCS is required for both coding and signal joint formation.


Article Text

V(D)J rearrangement is the mechanism by which gene segments (V, D, and J) are joined to form the coding sequences of Ig and TCR variable regions (1-3). Rearrangement involves two DNA cuts and religations and is mediated by a lymphoid-specific endonuclease (the RAG 1 and RAG 2 proteins) (4-8) and ubiquitous components of the DNA double-strand break repair (DSBR) pathway (2, 9-11). The centrality of V(D)J recombination to the development of the immune system is illustrated in situations where the process is impaired. Defective V(D)J recombination results in a complete block of B and T cell lymphopoiesis, and the disease severe combined immune deficiency (SCID). The first example of this phenomenon was reported by Bosma et al., who described a spontaneous mutation in C.B-17 mice resulting in defective V(D)J recombination and SCID (12). In SCID mice, the only step in V(D)J recombination that is impaired is the resolution of coding ends (13-17). In 1990, it was demonstrated that SCID mice also have impaired DSBR (18, 19). In recent years it has been shown that at least four factors are required for both V(D)J recombination and DSBR: the Ku heterodimer (Ku86/Ku70, XRCC5, and XRCC6), DNA-PKCS (XRCC7), and XRCC4 (9-11). Recently DNA-PKCS has been identified as the defective factor in C.B-17 SCID mice (20, 21). DNA-PKCS is related to the phosphatidylinositol 3-kinase (PI3K) family in which members function in a variety of roles such as signal transduction, control of cell cycle progression, and maintenance of telomere length (22-26). In sum, defects in either the lymphocyte-specific components of the V(D)J recombinase (RAG 1 -/- mice (27), Rag 2 -/- mice (28), RAG-deficient children (29)) or any one of these DSBR factors (C.B-17 SCID mice (20, 21), Arabian SCID foals (30), Ku80 -/- mice (31, 32)) block B and T lymphocyte development and result in a similar phenotype.

The occurrence of SCID in Arabian foals was reported in 1973; the disease is inherited as an autosomal recessive trait, suggesting that a defect in a single gene is responsible for equine SCID (33). Recently, we demonstrated that the defective mechanism in these animals is V(D)J recombination (30). As with SCID mice, equine SCID cells are hypersensitive to DNA damage because of severely diminished levels of DNA-PKCS. However, these two genetic defects have important mechanistic differences. Unlike SCID mice, which are preferentially defective in coding resolution, SCID foals are defective in both coding and signal joint resolution.

Materials and Methods

Oligonucleotides

The position of amplification primers is illustrated in Figure 1. Sequences of oligonucleotides were based on the published human cDNA (22) and are as follows: 262, GTATATGAGCTCCTAGG; 265, GGGAGAATCTCTCTGCAA; 266, GATCCAGCGGCTAACTTG; 285, CATGTGCTAAGGCCAGAC; 286, TCTACAGGGAATTCAGGG; 293, CACCATGAATCACACTTC; 296, CACCAAGGACTGAAACTT; 330, GCACTTTCATTCTGTCAC; 317, ATTCATGACCTCGAAGAG; 318, TGGACAAACAGATATCCAG; 259, ATCGCCGGGTTTGATGAGCGGGTG; 255, CAGACCTCACATCCAGGGCTCCCA; 348, GAGACGGATATTTAATG; 414, GGAGTGCAGAGCTATTCAT; 415, GCAATCGATTTGCTAACAC; 350, GTCCCTAAAGATGAAGTG; 382, GTCATGAATCCACATGAG; 357, TTCTTCCTGCTGCCAAAA; 358, CTTTGTTCCTATCTCACT; 383, AGACTTGCTGAGCCTCGA; 405, TTCCTGTTGCAAAAGGAG; 392, TTTGTGATGATGTCATCC; 396, TCAGGAGTTCATCAGCTT; N, AGGTAATTTATCATCTCA; S, AGGTAATTTATCAAATTC.

Figure 1

Figure 1:

Diagrammatic representation of the DNA-PKCS transcript. Arrows denote positions of oligonucleotide primers used to amplify transcripts. Each box represents an overlapping cDNA fragment derived from the 0176 and 1821 cell lines. We were unsuccessful in cloning the fragment from nucleotide 4950 to 9539 from the 1821 cell line. Thus, the sequence of the 0176 transcript was determined for this region, and then four separate fragments cloned and sequenced (denoted by dotted lines) from the 1821 cell line.



Reverse transcriptase PCR

The 0176 (normal) and 1821 (SCID) equine fibroblast cell lines have been described in detail previously (30, 34). RT-PCR was performed using Superscript II (reverse transcriptase) and Elongase (Taq polymerase) according to the manufacturer's recommendations (Life Technologies, Gaithersburg, MD). Amplified transcripts were subcloned and sequenced using standard techniques.

Genomic PCR

Genomic DNA was derived from eight different SCID foals and five normal animals (four Arabian and one non-Arabian). Diagnosis of SCID was established on the basis of lymphopenia, absence of IgM, and hypoplasia of lymphoid tissues. The intronic region adjacent to the mutated exon was isolated by amplifying spleen DNA from a SCID foal with primer combination 396/392. A 1.8-kb fragment was isolated that included portions of two exons separated by an ~1.5-kb intron. Primers 405 and 392 were used to screen for the mutant SCID allele. PCR conditions were 94° for 30 s, 55° for 90 s, and 68° for 5 min. Amplified DNA was analyzed by Southern hybridization using standard techniques.

Results

An RT-PCR strategy (Fig. 1) was used to clone and sequence the normal and SCID equine DNA-PKCS transcripts. cDNA was derived from two fibroblast cell lines, 0176 (derived from a normal, non-Arabian horse) and 1821 (derived from a SCID foal). Previously, we demonstrated that the 1821 cell line 1) was hypersensitive to ionizing radiation, 2) had no detectable DNA-PK activity, 3) lacked DNA-PKCS protein, and 4) could not support RAG-induced recombination as assayed by signal joint formation (30). We were able to sequence 11,883 nucleotides of the 12,384 DNA-PKCS transcript from both cell lines. Isolation of the first 570 bp of the transcripts was unsuccessful; this may indicate less conservation of this region. The deduced amino acid sequence of equine DNA-PKCS is compared with the human counterpart in Figure 2. Overall, the two proteins are 84% homologous. Homology within the PI3K domain is not dramatically higher than throughout the rest of the protein (87%). The region corresponding to subdomain II, as noted by Poltoratsky et al., which includes the conserved protein kinase motifs, is slightly more conserved (92%). The leucine zipper motif and 17 of 18 potential DNA-PK autophosphorylation sites (22) are conserved.


Figure 2

Figure 2:

Deduced amino acid sequence comparison of the equine DNA-PKCS transcript (derived from the 0176 cell line) compared with the human counterpart. Comparison starts at amino acid 180 of the human sequence. Potential DNA-PK autophosphorylation sites and leucine zipper motifs are underlined. The conserved protein kinase motifs are shown in bold. The five-nucleotide deletion occurs at amino acid 3155 (coincident with the SQ potential DNA-PK site) resulting in premature termination at amino acid 3160.

In the RT-PCR fragment spanning nucleotide ~8000 to ~9650 from the 1821 SCID cell line, a five-nucleotide deletion was found. The only other difference between the transcripts isolated from the two lines was a silent T>C transition at nucleotide 3025. Germline sequences encoding this region were isolated; a 1.8-kb fragment including portions of two exons and a 1.5-kb intron was cloned. Genomic fragments spanning this region from the 0176 and 1821 cell lines were then sequenced, confirming this five-nucleotide deletion in DNA derived from the 1821 cell line (Fig. 3).



Figure 3

Figure 3:

Sequence comparison of the genomic fragments isolated from the 1821 and 0176 cell lines. Splice site is underlined and deduced amino acid sequence of the normal and mutated exon is shown. Positions of amplification primers are denoted with arrows. The five-nucleotide deletion results in a frame-shift, which results in premature termination of the protein at the TAA termination codon (shown in bold).



To determine whether this deletion accounts for SCID in many Arabian foals or just a subset of affected animals, two oligonucleotide hybridization probes spanning this region representing the normal (N probe) and SCID (S probe) sequences were synthesized. In all of the SCID foals tested, the S probe hybridizes strongly; the probe specific for the normal allele does not hybridize (Fig. 4). Furthermore, in all samples from normal animals, the N probe hybridizes strongly. In two normal animals, both the N and S probes hybridize well, identifying these animals as heterozygotes. From these data, we conclude that this specific five-nucleotide deletion is responsible for a significant fraction of the cases of SCID in Arabian horses.

Figure 4

Figure 4:

Genomic PCR analysis of DNA derived from SCID and phenotypically normal animals using primer combinations 392/405. Amplified products were hybridized with the N probe (top) and the S probe (bottom). Phenotype and genotype (as determined by this analysis) are indicated below. S denotes SCID; N denotes normal; H denotes heterozygote.



Although the same five-nucleotide deletion was found in all equine samples tested, Western analysis of SCID cell lines does not reveal an immunoreactive protein of ~350 kD, the predicted molecular mass of the mutant SCID protein (Ref. 30, data not shown). Thus, it is likely that truncation of DNA-PKCS at amino acid 3160 results in an unstable form of the protein. However, a smaller immunoreactive species (~80 kD) is observed in both normal and SCID cells, which may represent relatively stable degradation products of DNA-PKCS (30). We cannot formally rule out the possibility that another mutation exists in the unsequenced 5´ 570 nucleotides of the equine DNA-PKCS allele.

Discussion

The data in this report establish that the defective factor responsible for SCID in Arabian foals is the catalytic subunit of the DNA-dependent protein kinase. Unlike the situation in the human disease ataxia telangiectasia, where mutations in the ATM gene (another PI3K family member) occur throughout the protein, the same mutation of DNA-PKCS is found in all SCID foals examined to date. Thus, since eight SCID foals have the identical DNA-PKCS mutation, it is likely that this DNA-PKCS allele has common origins resulting from a genetic "founder" effect.

The mechanistic differences between murine and equine SCID are clear and twofold. In SCID foals, both signal and coding joint ligation are impaired; whereas signal ligation is, by all criteria, normal in SCID mice (13-15, 30). In addition, whereas it is very easy to detect some coding ligation in SCID mice ("leaky" SCID phenotype), demonstration of any coding joint formation in SCID foals is exceedingly difficult (35). Thus, the biochemical evidence implicating DNA-PKCS in both of these genetic defects was initially paradoxical. The definition here of the specific DNA-PKCS mutation in equine SCID coupled with recent descriptions of the precise mutation responsible for murine SCID (36, 37) account for the observed mechanistic differences.

Figure 5 illustrates the result of the equine DNA-PKCS mutation and the murine SCID mutation (36, 37). The differences in the two mutated forms of DNA-PKCS are dramatic. In the murine mutation, the conserved regions shared between DNA-PKCS and other PI3K family members are intact. This region is absent in the mutated equine protein. Consistent with our previous findings (30), equine SCID cells can have no DNA-dependent kinase activity because the mutation precludes expression of a kinase active version of DNA-PKCS. Clearly, SCID mice have diminished levels of DNA-PK activity; however, since the mutation in SCID mice preserves most of the PI3K homology domain, some kinase activity may be present. Thus, an attractive hypothesis is that preferentially defective coding vs signal resolution may result from diminished levels of DNA-PK activity, whereas absence of DNA-PK activity impairs both signal and coding ligation.

Figure 5

Figure 5:

Diagrammatic representation of equine and murine mutant DNA-PKCS proteins. Subregions of homology to other PI3K family members are as noted by Poltoratsky et al. (23). The murine SCID mutation results in an 80-amino acid truncation, which leaves the PI3K domain intact. The equine SCID mutation results in a 967-amino acid truncation, which deletes the PI3K domain.


Our description of defective signal ligation in SCID foals is not the only evidence linking DNA-PKCS to signal ligation. A Chinese hamster ovary cell line, V3, defective in DNA-PKCS expression has also been defined; complementation studies have unequivocally defined DNA-PKCS as the defective factor in this cell line (38, 39). Two reports have demonstrated that, like murine SCID cells, the V3 cell line cannot support V(D)J coding end resolution; however, signal resolution in these cells is modestly reduced as assessed both by recombination frequency (~50% reduced) and in precision of signal junctions isolated (60-80% precise) (10, 40). The specific mutation responsible for diminished DNA-PKCS expression in V3 cells has not been determined, but it is likely to permit some residual DNA-PKCS expression.

xrs6 cells, which are defective in the regulatory subunit of DNA-PK, Ku (they are specifically defective in Ku86), are incapable of either signal or coding ligation (9, 10, 40). The Ku86 mutation in xrs6 cells has recently been defined as a 13-nucleotide deletion in the most 5´ region of the transcript (41), which results in complete absence of Ku86 expression. Recently, Errami et al. derived several xrs6 revertants that had a range of Ku86 expression (from none to wild type levels). In transfectants with reduced, but detectable levels of Ku86, signal ligation was preferentially restored, analogous to the circumstance observed both in murine SCID cells and the V3 DSBR mutant. Thus, these data support and extend our conclusion that coding end resolution is more sensitive to diminished levels of Ku or DNA-PKCS than is signal joint resolution. Complete absence of Ku or DNA-PKCS results in deficient signal and coding ligation.

References

  1. Lewis, S. M. 1994. Adv. Immunol. 56:27.
  2. Weaver, D. T. 1995. Adv. Immunol. 58:29.
  3. Lewis, S., A. Gifford, and D. Baltimore. 1985. Science 228:677.
  4. Schatz, D. G., M. A. Oettinger, and D. Baltimore. 1989. Cell 59:1035.
  5. Oettinger, M. A., D. G. Schatz, C. Gorka, and D. Baltimore. 1990. Science 248:1517.
  6. McBlane, J. F., D. C. van Gent, D. A. Ramsden, C. Romeo, C. A. Cuomo, M. Gellert, and M. A. Oettinger. 1995. Cell 83:387.
  7. Eastman, Q. M., T. M. Leu, and D. G. Schatz. 1996. Nature 380:85.
  8. Vangent, D. C., D. A. Ramsden, and M. Gellert. 1996. Cell 85:107.
  9. Taccioli, G. E., G. Rathbun, E. Oltz, T. Stamato, P. A. Jeggo, and F. W. Alt. 1993. Science 260:207.
  10. Pergola, F., M. Z. Zdzienicka, and M. R. Lieber. 1993. Mol. Cell. Biol. 13:3464.
  11. Lee, S. E., C. R. Pulaski, D. M. He, D. M. Benjamin, M. Voss, J. Um, and E. A. Hendrickson. 1995. Mutat. Res. 336:279.
  12. Bosma, G. C., R. P. Custer, and M. J. Bosma. 1983. Nature 301:527.
  13. Lieber, M. R., J. E. Hesse, S. Lewis, G. C. Bosma, N. Rosenberg, K. Mizuuchi, M. J. Bosma, and M. Gellert. 1988. Cell 55:7.
  14. Schuler, W., I. J. Weiler, A. Schuler, R. A. Phillips, N. Rosenberg, T. W. Mak, J. F. Kearney, R. P. Perry, and M. J. Bosma. 1986. Cell 46:963.
  15. Malynn, B. A., T. K. Blackwell, G. M. Fulop, G. A. Rathbun, A. J. Furley, P. Ferrier, L. B. Heinke, R. A. Phillips, G. D. Yancopoulos, and F. W. Alt. 1988. Cell 54:453.
  16. Roth, D. B., J. P. Menetski, P. B. Nakajima, M. J. Bosma, and M. Gellert. 1992. Cell 70:983.
  17. Zhu, C., and D. B. Roth. 1995. Immunity 2:101.
  18. Fulop, G. M., and R. A. Phillips. 1990. Nature 347:479.
  19. Biedermann, K. A., J. R. Sun, A. J. Giaccia, L. M. Tosto, and J. M. Brown. 1991. Proc. Natl. Acad. Sci. USA 88:1394.
  20. Blunt, T., N. J. Finnie, G. E. Taccioli, G. C. Smith, J. Demengeot, T. M. Gottlieb, R. Mizuta, A. J. Varghese, F. W. Alt, P. A. Jeggo, et al. 1995. Cell 80:813.
  21. Kirchgessner, C. U., C. K. Patil, J. W. Evans, C. A. Cuomo, L. M. Fried, T. Carter, M. A. Oettinger, and J. M. Brown. 1995. Science 267:1178.
  22. Hartley, K. O., D. Gell, G. C. Smith, H. Zhang, N. Divecha, M. A. Connelly, A. Admon, S. P. Lees-Miller, C. W. Anderson, and S. P. Jackson. 1995. Cell 82:849.
  23. Poltoratsky, V. P., X. Shi, J. D. York, M. R. Lieber, and T. H. Carter. 1995. J. Immunol. 155:4529.
  24. Anderson, C. W., and S. P. Lees-Miller. 1992. Crit. Rev. Eukaryotic Gene Expression 2:283.
  25. Lees-Miller, S. P., K. Sakaguchi, S. J. Ullrich, E. Appella, and C. W. Anderson. 1992. Mol. Cell. Biol. 12:5041.
  26. Boubnov, N. V., and D. T. Weaver. 1995. Mol. Cell. Biol. 15:5700.
  27. Mombaerts, P., J. Iacomini, R. S. Johnson, K. Herrup, S. Tonegawa, and V. E. Papaioannou. 1992. Cell 68:869.
  28. Shinkai, Y., G. Rathbun, K. P. Lam, E. M. Oltz, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A. M. Stall, and F. W. Alt. 1992. Cell 68:855.
  29. Schwarz, K., G. H. Gauss, L. Ludwig, U. Pannicke, Z. Li, D. Lindner, W. Friedrich, R. A. Seger, T. E. Hansenhagge, S. Desiderio, M. R. Lieber, and C. R. Bartram. 1996. Science 274:97.
  30. Wiler, R., R. Leber, B. B. Moore, L. F. VanDyk, L. E. Perryman, and K. Meek. 1995. Proc. Natl. Acad. Sci. USA 92:11485.
  31. Zhu, C. M., M. A. Bogue, D. S. Lim, P. Hasty, and D. B. Roth. 1996. Cell 86:379.
  32. Nussenzweig, A., C. H. Chen, V. D. Soares, M. Sanchez, K. Sokol, M. C. Nussenzweig, and G. C. Li. 1996. Nature 382:551.
  33. McGuire, T. C., and M. J. Poppie. 1973. Infect. Immun. 8:272.
  34. Magnuson, N. S., D. M. Decker, and L. E. Perryman. 1983. Clin. Immunol. Immunopathol. 29:391.
  35. Leber, R., R. Wiler, L. E. Perryman, and K. Meek. 1997. Vet. Immunol. Immunopathol. In press.
  36. Blunt, T., D. Gell, M. Fox, G. E. Taccioli, A. R. Lehmann, S. P. Jackson, and P. A. Jeggo. 1996. Pro. Natl. Acad. Sci. USA 93:10285.
  37. Danska, J. S., D. P. Holland, S. Mariathasan, K. M. Williams, and C. J. Guidos. 1996. Mol. Cell. Biol. 16:5507.
  38. Taccioli, G. E., T. M. Gottlieb, T. Blunt, A. Priestley, J. Demengeot, R. Mizuta, A. R. Lehmann, F. W. Alt, S. P. Jackson, and P. A. Jeggo. 1994. Science 265:1442.
  39. Errami, A., V. Smider, W. K. Rathmell, D. M. He, E. A. Hendrickson, M. Z. Zdzienicka, and G. Chu. 1996. Mol. Cell. Biol. 16:1519.
  40. Taccioli, G. E., H. L. Cheng, A. J. Varghese, G. Whitmore, and F. W. Alt. 1994. J. Biol. Chem. 269:7439.
  41. Mizuta, R., G. E. Taccioli, and F. W. Alt. 1996. Int. Immunol. 8:1467.